| 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| T | T | A | C | A | A | T | C | C | G | A | T | C | G | T |
| T | T | A | C | G | A | T | G | C | G | C | T | C | G | T |
| T | C | A | C | A | A | T | G | C | G | A | T | G | G | A |
| T | T | A | C | G | A | T | G | C | G | C | T | C | G | T |
| * | * | * | * | * | * |
\[ \begin{align} \pi & = \sum_{j=1}^S h_j = \sum_{j=1}^{S} \frac{n}{n-1}\left(1 - \sum_i p_i^2 \right) \\ & \stackrel{S=6,\\ n=4}{=} \sum_{j=1}^{6} \frac{4}{3}\left(1 - \sum_i p_i^2\right) \\ & = \frac{4}{3}\left(\mathbf{\color{#a7c947}{4}}\left(1-\frac{1}{16}- \frac{9}{16}\right) + \mathbf{\color{#a7c947}{2}}\left(1 - \frac{1}{4} - \frac{1}{4}\right)\right) = \frac{10}{3} \end{align} \]
\[ \begin{align} \pi & = \frac{\sum_{i=1}^{n-1}i(n-i)\xi_i}{n(n-1)/2} \\ & \stackrel{n=4}{=} \frac{1*(4-1)*4 + 2*(4-2)*2}{6} = \frac{10}{3} \end{align} \]
This is not how real data looks like from the beginning…
@SRR9309790.10003134
TAAATCGATTCGTTTTTGCTATCTTCGTCT
+
AAFFFJJJJJJJFJJJJJJJJJJJJJJJJJ
@SRR9309790.10003222
TAAATCGATTCGTTTTTGCTATCTTCGTCT
+
AAFFFJJJJJJJJJJJJJJJJJJJJJJJJJ
30431 30441 30451 30461
CATTGGCAATGGCATCAGTTGAGCATCTTAGTACGAACTAAAAGCTG
...............M...............................
...............A...
...............A.................
..............................................
..............................................
..............................................
...............A...............................
...............A...............................
,,,,,,,,,,,,a,,a,,,,,,,,,,,,,,,,,,,,,,,,,,,,a,,
,,,,,,,,,,,,,,,a,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,
,,,,,,,,,,,,,,,a,,,,,,,,,,,,,,,,,,,,,,a,,,,,aa,
,,,,,,,,,,,,,,,a,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,
,,,,,,,,,,,,,a,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,

Nielsen et al. (2011)
Knowing variant sites informs us of possible genotypes and improves genotyping.
Example: knowing a site has A or C limits possible genotype calls to AA, AC, or CC

Scale up and down with a tunable output of up to 6 Tb and 20B single reads in < 2 days.
Up to 2X250 bp read length. Price example: 8,000 SEK total for resequencing 3Gbp genome to 30X
Up to 360 Gb of HiFi reads per day, equivalent to 1,300 human whole genomes per year.
Tens of kilobases long HiFi reads. Price example (Sequel II): ~35kSEK per library and SMRT cell
-rw-r--r-- 1 runner docker 302K Nov 15 11:10 PUN-Y-INJ_R1.fastq.gz
-rw-r--r-- 1 runner docker 393K Nov 15 11:10 PUN-Y-INJ_R2.fastq.gz
Format:
@)+)Quality values represent the probability \(P\) that the call is incorrect. They are coded as Phred quality scores \(Q\). Here, \(Q=20\) implies 1% probability of error, \(Q=30\) 0.1% and so on. Typically you should not rely on quality values below \(20\).
\[ Q = -10 \log_{10} P \]
Despite price drop, still need to make choices regarding depth and breadth of sequencing coverage and number of samples.

. characters is the consensus sequence. Bases are colored by nucleotide. Letter case indicates forward (upper-case) or reverse (lower-case) alignment. * is placeholder for deleted base.
Aim of sequence alignment (read mapping) is to determine source in reference sequence. Some commonly used read mappers for resequencing are
For a recent comprehensive comparison see Donato et al. (2021)
@HD VN:1.6 SO:coordinate
@SQ SN:LG4 LN:100000
@RG ID:SRR9309790 SM:PUN-Y-INJ PL:ILLUMINA
@PG ID:bwa PN:bwa VN:0.7.17-r1188 CL:bwa mem -R @RG\tID:SRR9309790\tSM:PUN-Y-INJ\tPL:ILLUMINA -p -t 14 -M tiny/M_aurantiacus_v1_splitline_ordered.fasta -
Format: metadata record types prefixed with @, e.g., @RG is the read group
SRR9309790.7750070 65 LG4 1 39 45S9M1I96M = 83782 83781 TGAACTATAGTCGATGGGACGAATACCCCCCTGAACTTGCGAAGGGGACAATTACCCCCCTCTGTTATGTTTCAGTCAATTTCATGTTTGATTTTTAGATTTTTAATTAATTATATATTTTTTGCAATTTGTAACCTCTTTAACCTTTATT AAFFFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJAJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJFJJJJJJJJJJJFFJFJJJJJJJJJJFJJJJJJJJFJJJJJJJJJAJJJJJJJJJJJJJJJJJFA<FFJJ7FF SA:Z:LG4,83018,+,30M2I28M91S,37,5; MC:Z:12S10M2I123M4S MD:Z:16C28C59 PG:Z:MarkDuplicates RG:Z:SRR9309790 NM:i:3 MQ:i:50 AS:i:88 XS:i:70 ms:i:5185
Some important columns: 1:QUERY, 3:REFERENCE, 4:POSITION, 5:MAPQ, 6:CIGAR. The CIGAR string compiles information on the alignment, such as match (M), soft clipping (S), and insertion to reference (I)
samtools tview30431 30441 30451 30461 30471
CATTGGCAATGGCATCAGTTGAGCATCTTAGTACGAACTAAAAGCTGCGAAAAAATATTT
...............M............................................
...............A... ,,,,,,,,,,
...............A................. ,,,,,,,,,,
.............................................. ,,,,,,,,
..............................................
..............................................
...............A............................................
...............A............................................
,,,,,,,,,,,,a,,a,,,,,,,,,,,,,,,,,,,,,,,,,,,,a,,a,,,,,,,,,,,,
,,,,,,,,,,,,,,,a,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,
,,,,,,,,,,,,,,,a,,,,,,,,,,,,,,,,,,,,,,a,,,,,aa,a,,,,,,,,,,,,
,,,,,,,,,,,,,,,a,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,
,,,,,,,,,,,,,a,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,
30431 30441 30451 30461 30471
CATTGGCAATGGCATCAGTTGAGCATCTTAGTACGAACTAAAAGCTGCGAAAAAATATTT
...............A............................................
,,,,,,, ..........................
...............A..... .....................
...............A...A.... .....................
...............A.........
...............A...........C.............
,,,,,,,,,,,,,,,a,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,
,,,,,,,,,,,,,,,a,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,
...............A............................................
,,,,,,,,,,,,,,,a,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,
,,,,,,,,,,,,,,,a,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,
,,,,,,,,,,,,,,,a,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,
,,,,,,,,,,,,,,,a,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,
...............A............................................
,,,g,,,,,,,a,,,a,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,
.............A............................................
Aka pileup format. Forward (.) and backward (,) mapping reads. Mismatches shown as letters.
30431 30441 30451 30461 30471
CATTGGCAATGGCATCAGTTGAGCATCTTAGTACGAACTAAAAGCTGCGAAAAAATATTT
...............M............................................
...............A... ,,,,,,,,,,
...............A................. ,,,,,,,,,,
.............................................. ,,,,,,,,
..............................................
..............................................
...............A............................................
...............A............................................
,,,,,,,,,,,,a,,a,,,,,,,,,,,,,,,,,,,,,,,,,,,,a,,a,,,,,,,,,,,,
,,,,,,,,,,,,,,,a,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,
,,,,,,,,,,,,,,,a,,,,,,,,,,,,,,,,,,,,,,a,,,,,aa,a,,,,,,,,,,,,
,,,,,,,,,,,,,,,a,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,
,,,,,,,,,,,,,a,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,
30431 30441 30451 30461 30471
CATTGGCAATGGCATCAGTTGAGCATCTTAGTACGAACTAAAAGCTGCGAAAAAATATTT
...............A............................................
,,,,,,, ..........................
...............A..... .....................
...............A...A.... .....................
...............A.........
...............A...........C.............
,,,,,,,,,,,,,,,a,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,
,,,,,,,,,,,,,,,a,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,
...............A............................................
,,,,,,,,,,,,,,,a,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,
,,,,,,,,,,,,,,,a,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,
,,,,,,,,,,,,,,,a,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,
,,,,,,,,,,,,,,,a,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,
...............A............................................
,,,g,,,,,,,a,,,a,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,
.............A............................................
Potential variants show up as multiple mismatches in a column. Two questions arise:
Simple approach: filter bases on quality (e.g., Q20), call heterozygous if 20-80% bases non-reference.
Issues: undercalls heterozygotes, no measure of uncertainty
Solution: probabilistic methods!
TGC
.K.
...
,,,
.T.
.T.
...
,,,
,t,
Goal: calculate likelihood of observing \(X=\)G,g,T,T,G,g,t from a genotype \(G\). We assume each observation \(X_i\) can be treated independently. We restrict possible genotypes to the observed alleles (i.e., G, T). Some observations:
Prob(\(X_1=\)G assuming genotype T,T) = P(\(X_1=\)G|T,T) = \(0\)
Prob(\(X_1=\)G assuming genotype G,G) = P(\(X_1=\)G|G,G) = \(1\)
Prob(\(X_1=\)G assuming genotype G,T) = P(\(X_1=\)G|G,T) = \(0.5\)
To get total likelihood \(P(X|G)\) assuming a genotype \(G\) (here G,T), we can multiply over all observations (reads):
\[ \begin{align} P(X|G,T) & = P(X_1=G|G,T)P(X_2=g|G,T)P(X_3=T|G,T)P(X_4=T|G,T) \\ & P(X_5=G|G,T)P(X_6=g|G,T)P(X_7=t|G,T) = 0.5^7 \end{align} \]
TGC
.K.
...
,,,
.T.
.T.
...
,,,
,t,
For a given site, we have a number of observations \(X\). We have shown we can calculate the likelihood of observing \(X\) given a genotype \(G\), \(P(X|G)\).
However; what we really want to know is the most likely genotype \(G\) given the data \(X\), or \(P(G|X)\).
Apply Bayes’ theorem:
\[ P(G|X) \sim P(X|G)\cdot P(G) \]
\[ \text{posterior} \sim \text{likelihood} \cdot \text{prior} \]
Consequently we need to set a prior on \(G\). If allele frequencies are known, we can constrain the frequencies; for example, if A is known to be low (\(\sim1\)%) AA genotype is very unlikely. Otherwise, could set all equal (flat prior).
We have outlined a probabilistic approach to variant calling where we obtain a posterior probability of observing a genotype \(G\) given data \(X\):
\[ P(G|X) \sim P(X|G)P(G) \]
Assuming a bi-allelic site, and letting \(H_1, H_2\) denote the two alleles, we have three possible genotype likelihoods \(P(H_1H_1|X)\), \(P(H_1H_2|X)\), and \(P(H_2H_2|X)\).
The highest posterior probability is typically chosen as the genotype call, with a measure confidence represented by the genotype probability or ratio between the two most probable calls.
Genotype likelihoods are often represented as Phred-scaled likelihoods (again!):
\[ \text{QUAL} = -10 \log_{10} P(G|X) \]
bcftools view --header-only allsites.vcf.gz | head --lines 1
bcftools view --header-only allsites.vcf.gz | grep "##FILTER"
bcftools view -h allsites.vcf.gz | grep "##INFO" | head -n 4
bcftools view -h allsites.vcf.gz | grep "##FORMAT" | head -n 8##fileformat=VCFv4.2
##FILTER=<ID=PASS,Description="All filters passed">
##FILTER=<ID=LowQual,Description="Low quality">
##INFO=<ID=AC,Number=A,Type=Integer,Description="Allele count in genotypes, for each ALT allele, in the same order as listed">
##INFO=<ID=AF,Number=A,Type=Float,Description="Allele Frequency, for each ALT allele, in the same order as listed">
##INFO=<ID=AN,Number=1,Type=Integer,Description="Total number of alleles in called genotypes">
##INFO=<ID=BaseQRankSum,Number=1,Type=Float,Description="Z-score from Wilcoxon rank sum test of Alt Vs. Ref base qualities">
##FORMAT=<ID=AD,Number=R,Type=Integer,Description="Allelic depths for the ref and alt alleles in the order listed">
##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Approximate read depth (reads with MQ=255 or with bad mates are filtered)">
##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">
##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
##FORMAT=<ID=MIN_DP,Number=1,Type=Integer,Description="Minimum DP observed within the GVCF block">
##FORMAT=<ID=PGT,Number=1,Type=String,Description="Physical phasing haplotype information, describing how the alternate alleles are phased in relation to one another; will always be heterozygous and is not intended to describe called alleles">
##FORMAT=<ID=PID,Number=1,Type=String,Description="Physical phasing ID information, where each unique ID within a given sample (but not across samples) connects records within a phasing group">
##FORMAT=<ID=PL,Number=G,Type=Integer,Description="Normalized, Phred-scaled likelihoods for genotypes as defined in the VCF specification">
FILTER defines applied filters , INFO fields provide additional information to genotypes, FORMAT specification fields define genotype entries, and more. NB: PL format definition.
bcftools view --header-only --samples PUN-R-ELF,PUN-Y-INJ allsites.vcf.gz |\
tail --lines 1
bcftools view --no-header --samples PUN-R-ELF,PUN-Y-INJ allsites.vcf.gz LG4:6886#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT PUN-R-ELF PUN-Y-INJ
LG4 6886 . C T 722.43 . AC=2;AF=0.222;AN=4;BaseQRankSum=0;DP=82;ExcessHet=1.8123;FS=1.309;InbreedingCoeff=-0.155;MLEAC=4;MLEAF=0.222;MQ=60;MQRankSum=0;QD=18.52;ReadPosRankSum=0.577;SOR=0.44 GT:AD:DP:GQ:PGT:PID:PL:PS 0/1:3,8:11:50:.:.:189,0,50:. 0/1:2,2:4:45:.:.:45,0,45:.
QUAL: Phred-scaled quality score for Prob(ALT is wrong): \(722.43\) (\(p=10^{-Q/10}=5.7e-73\))
INFO field summarizes data for all samples. For instance:
AC=2)AF=0.222)#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT PUN-R-ELF PUN-Y-INJ
LG4 6886 . C T 722.43 . AC=2;AF=0.222;AN=4;BaseQRankSum=0;DP=82;ExcessHet=1.8123;FS=1.309;InbreedingCoeff=-0.155;MLEAC=4;MLEAF=0.222;MQ=60;MQRankSum=0;QD=18.52;ReadPosRankSum=0.577;SOR=0.44 GT:AD:DP:GQ:PGT:PID:PL:PS 0/1:3,8:11:50:.:.:189,0,50:. 0/1:2,2:4:45:.:.:45,0,45:.
GT:AD:DP:GQ:PGT:PID:PL:PS)
PUN-R-ELF: 0/1:3,8:11:50:.:.:189,0,50:.
GT=0/1, AD=3,8 => 3 REF, 8 ALT, DP=11 => sequence depth = 11, PL=189,0,50
PUN-Y-INJ: 0/1:2,2:4:45:.:.:45,0,45:.
GT=0/1, AD=2,2 => 2 REF, 2 ALT, DP=4 => sequence depth = 4, PL=45,0,45
Can convert Phred-scaled quality scores to probabilities as
\[ p = 10^{-Q/10} \]
For PUN-R-ELF the relative probabilities are \(10^{-189/10}\approx1.26e-9\), \(10^{0}=1\), \(10^{50}=10^{-5}\).
Interpretation: 0/1 10,000 times more likely than 1/1 (\(1/10^{-5}\))
TCT
.Y.
.T.
...
.T.
,,,
.T.
,,,
.T.
...
...
...
,t,
,t,
,t,
,t,
TCT
.Y.
.T.
...
,,,
,,,
,,,
.T.
:::::
::::::
For low-coverage sequencing. Doesn’t do explicit genotyping; most methods take genotype uncertainty into account.
Reference bias: plot no. hets vs coverage for real data, e.g., conifer

From https://jgi.doe.gov/csp-2021-genomic-resources-for-mimulus/
Plants in the genus Mimulus inhabit highly variable habitats and are famous for their extraordinary ecological diversity. Mimulus is now a powerful system for ecological genomic studies, thanks to its experimental tractability, rapidly growing research community, and the JGI-generated reference genome for M. guttatus.
Follow GATK best practices to
Variant calling